Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs759317757
rs759317757
0.807 0.280 8 91078416 frameshift variant TTAAC/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs869312713
rs869312713
0.882 0.320 16 89280070 stop gained C/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs28936415
rs28936415
0.752 0.320 16 8811153 missense variant G/A snv 4.1E-03 3.7E-03
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs376754460
rs376754460
0.807 0.280 16 8801859 missense variant G/A;C;T snv 8.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs776679653
rs776679653
0.827 0.200 9 86266174 missense variant C/T snv 4.2E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs796051877
rs796051877
GAA
0.807 0.320 17 80110055 splice region variant G/A snv 4.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2015 2015
dbSNP: rs312262690
rs312262690
0.752 0.320 4 79984831 frameshift variant -/G;GG delins 1.7E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1562127631
rs1562127631
0.742 0.360 6 78961751 frameshift variant C/- del
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555377415
rs1555377415
0.827 0.200 14 77027274 stop gained G/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1057519566
rs1057519566
0.851 0.160 7 76063579 missense variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs375002796
rs375002796
0.851 0.160 7 76058047 missense variant C/T snv 5.2E-05 2.8E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs730882246
rs730882246
0.807 0.200 14 74494329 missense variant G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs80358263
rs80358263
0.827 0.280 14 74486378 stop gained G/T snv 8.4E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1563183492
rs1563183492
0.708 0.520 7 70766248 missense variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs863224880
rs863224880
0.925 0.160 11 68906074 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs782736894
rs782736894
0.827 0.280 17 67975841 missense variant T/C;G snv 4.0E-06 7.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs1555639411
rs1555639411
0.790 0.360 17 67894102 frameshift variant -/G delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs1555639076
rs1555639076
0.790 0.400 17 67893677 splice donor variant A/- delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2017 2017
dbSNP: rs188675529
rs188675529
0.827 0.240 16 67842794 missense variant C/G;T snv 1.6E-03 6.0E-04
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1057518733
rs1057518733
0.807 0.280 17 63837439 splice donor variant A/G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555580263
rs1555580263
0.827 0.240 17 63837200 stop gained -/AGGTAGAACCTTATCTGCCATCTTC delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1057518731
rs1057518731
0.807 0.280 17 63833908 splice donor variant C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1043679457
rs1043679457
0.752 0.400 5 60927745 intron variant C/A;G;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs121434341
rs121434341
0.807 0.360 8 60855993 missense variant C/A;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs757075712
rs757075712
0.763 0.200 10 58390856 missense variant C/T snv 1.6E-05 1.4E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0